Beginning Perl for Bioinformatics by James Tisdall

By James Tisdall

With its hugely built capability to discover styles in info, Perl has develop into probably the most renowned languages for organic info research. but when you're a biologist with very little programming adventure, beginning out in Perl could be a problem. Beginning Perl for Bioinformatics is designed to get you quick over the Perl language barrier through coming near near programming as a tremendous new laboratory ability, revealing Perl courses and methods which are instantly priceless within the lab. each one bankruptcy makes a speciality of fixing a selected bioinformatics challenge or category of difficulties, beginning with the best and lengthening in complexity because the e-book progresses. every one bankruptcy contains programming routines. by means of the top of the e-book you'll have an effective figuring out of Perl fundamentals, a suite of courses for such initiatives as parsing BLAST and GenBank, and the talents to tackle extra complex bioinformatics programming.

Show description

Read Online or Download Beginning Perl for Bioinformatics PDF

Best bioinformatics books

Microarrays for an Integrative Genomics

Useful genomics--the deconstruction of the genome to figure out the organic functionality of genes and gene interactions--is the most fruitful new parts of biology. The turning out to be use of DNA microarrays permits researchers to evaluate the expression of tens of millions of genes at a time. This quantitative swap has ended in qualitative growth in our skill to appreciate regulatory procedures on the mobile point.

DNA Topoisomerase Protocols Volume 1: DNA Topology and Enzymes (Methods in Molecular Biology Vol 94)

Starting with the Escherichia coli co protein, or bacterial DNA topoisomerase I, an ever-increasing variety of enzymes has been pointed out that catalyze adjustments within the linkage of DNA strands. DNA topoisomerases are ubiquitous in nature and feature been proven to play severe roles in such a lot p- cesses related to DNA, together with DNA replication, transcription, and rec- bination.

The Promise of Neural Networks

This booklet is the manufactured from a 15-month in depth research of the ecu synthetic community scene, including a view of the wider framework of the topic in an international context. it will probably no longer were accomplished in this type of remarkably few minutes, and so successfully, with out the devoted efforts of Louise Turner, the DEANNA secretary, and Geoff Chappell, the DEANNA researcher, on the Centre for Neural Networks, King's university, London.

Additional resources for Beginning Perl for Bioinformatics

Example text

The substitution operator is an example of the use of regular expressions. Regular expressions are the key to text manipulation, one of the most powerful features of Perl as you'll see in later chapters. 5 Using the Perl Documentation A Perl programmer's most important resource is the Perl documentation. It should be installed on your computer, and it may also be found on the Internet at the Perl site. The Perl documentation may come in slightly different forms on your computer system, but the web version is the same for everybody.

So, to summarize what we've learned so far about this statement: $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; It's an assignment statement that sets the value of the scalar variable $DNA to a string representing some DNA. 4 Print The statement: print $DNA; prints ACGGGAGGACGGGAAAATTACTACGGCATTAGC out to the computer screen. Notice that the print statement deals with scalar variables by printing out their values—in this case, the string that the variable $DNA contains. You'll see more about printing later.

The answer depends on what you hope to accomplish. There are several ways to get started. You can: Take classes of many different kinds Read a tutorial book like this one Get the programming manuals and plunge in Be tutored by a programmer Identify a program you need Try any and all of the above until you've managed to write the program The answer also depends on how you choose to learn. Some people prefer classes, because the information is often presented in a well-organized way, and questions can be answered by the teacher.

Download PDF sample

Rated 4.76 of 5 – based on 45 votes