Data analysis tools for DNA microarrays by Sorin Drăghici

By Sorin Drăghici

Know-how this present day permits the gathering of organic details at an extraordinary point of aspect and in more and more big amounts. to harvest actual wisdom from the mountains of information produced, even if, calls for interdisciplinary skills-a history not just in biology but in addition in desktop technology and the instruments and strategies of knowledge analysis.

To support meet the demanding situations of DNA learn, information research instruments for DNA Microarrays builds the root within the information and knowledge research instruments wanted via biologists and offers the evaluate of microarrays wanted by way of desktop scientists. It first provides the fundamentals of microarray expertise and extra importantly, the categorical difficulties the know-how poses from the information research point of view. It then introduces the basics of facts and the main points of the recommendations most ordinarily used to investigate microarray facts. the ultimate bankruptcy makes a speciality of advertisement purposes with sections exploring numerous software program programs from BioDiscovery, Insightful, SAS, and Spotfire. The booklet is richly illustrated with greater than 230 figures in complete colour and springs with a CD-ROM containing full-feature trial models of software program for picture research (ImaGene, BioDiscovery Inc.) and information research (GeneSight, BioDiscovery Inc. and S-Plus Array Analyzer, Insightful Inc.).

Written in easy language and illustrated in complete colour, information research instruments for DNA Microarrays lowers the conversation barrier among lifestyles scientists and analytical scientists. It prepares these charged with reading microarray facts to make trained offerings in regards to the innovations to take advantage of in a given scenario and give a contribution to extra advances within the box.

Show description

Read Online or Download Data analysis tools for DNA microarrays PDF

Similar bioinformatics books

Microarrays for an Integrative Genomics

Sensible genomics--the deconstruction of the genome to figure out the organic functionality of genes and gene interactions--is probably the most fruitful new components of biology. The transforming into use of DNA microarrays permits researchers to evaluate the expression of tens of millions of genes at a time. This quantitative switch has ended in qualitative growth in our skill to appreciate regulatory methods on the mobile point.

DNA Topoisomerase Protocols Volume 1: DNA Topology and Enzymes (Methods in Molecular Biology Vol 94)

Starting with the Escherichia coli co protein, or bacterial DNA topoisomerase I, an ever-increasing variety of enzymes has been pointed out that catalyze adjustments within the linkage of DNA strands. DNA topoisomerases are ubiquitous in nature and feature been proven to play serious roles in such a lot p- cesses concerning DNA, together with DNA replication, transcription, and rec- bination.

The Promise of Neural Networks

This ebook is the fabricated from a 15-month extensive research of the eu man made community scene, including a view of the wider framework of the topic in an international context. it will possibly now not were accomplished in any such remarkably few minutes, and so successfully, with no the devoted efforts of Louise Turner, the DEANNA secretary, and Geoff Chappell, the DEANNA researcher, on the Centre for Neural Networks, King's university, London.

Extra resources for Data analysis tools for DNA microarrays

Example text

The issue of translating lists of differentially regulated genes into biological knowledge is discussed in Chap. 14. 7. Array quality assessment. It is useful if data analysis is not seen as the last step in a linear process of microarray exploration but rather as a step that completes a loop and provides Copyright 2003 by Chapman & Hall/CRC 2003 Chapman & Hall/CRC the feedback necessary to fine-tune the laboratory procedures that produced the microarray. Thus, array quality assessment is an aspect that should be included among the goals of the data analysis.

Novel techniques need to be developed in order to address such questions. 6. Biological factors. In spite of their many advantages, microarrays are not necessarily able to substitute completely other tools in the arsenal of the molecular biologist. For instance, knocking out genes is slow and expensive but offer an unparalleled way of studying the effects of a gene well beyond its mRNA expression levels. In the normal cell, the RNA polymerase transcribes the DNA into mRNA which carries the information to ribosomes where the protein is assembled by tRNA in the translation process.

Several steps later, each area has its own sequence as designed. Copyright 2003 by Chapman & Hall/CRC 2003 Chapman & Hall/CRC gene A ACGTGCAATGCCGTACGGCAC A C G T G C A A T G C C G mismatch A C G T G C G A T G C C G The hybridization happens at a critical temperature when the PM hybridizes and even a single mismatch prevents the MM from hybridizing. 4: The principle of the Affymetrix technology. The probes correspond to short oligonucleotide sequences thought to be representative for the given gene.

Download PDF sample

Rated 4.23 of 5 – based on 26 votes